Быстрый заказ

Text Size:AAA

Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IGF1R Информация о продукте «Клон cDNA»
Размер кДНК:4104bp
Описание кДНК:Full length Clone DNA of Homo sapiens insulin-like growth factor 1 receptor with N terminal Myc tag.
Синоним гена:IGF1R, CD221, IGFIR, JTK13, MGC18216, MGC142170, MGC142172
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10164-ACGRBS25660
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10164-ACRRBS25660
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10164-CFRBS23610
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10164-CHRBS23610
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10164-CMRBS23610
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10164-CYRBS23610
Человек IGF1R/CD221/IGF-I R Джин клон кДНК в вектор клонированияHG10164-MRBS5130
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10164-NFRBS23610
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10164-NHRBS23610
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10164-NMRBS23610
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10164-NYRBS23610
Человек IGF1R/CD221/IGF-I R Джин ORF экспрессии кДНК клона плазмидыHG10164-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The insulin-like growth factor-1 receptor (IGF1R) is a transmembrane tyrosine kinase involved in several biological processes including cell proliferation, differentiation, DNA repair, and cell survival. This a disulfide-linked heterotetrameric transmembrane protein consisting of two α and two β subunits, and among which, the α subunit is extracellular while the β subunit has an extracellular domain, a transmembrane domain and a cytoplasmic tyrosine kinase domain. IGF1R signalling pathway is activated in the mammalian nervous system from early developmental stages. Its major effect on developing neural cells is to promote their growth and survival. This pathway can integrate its action with signalling pathways of growth and morphogenetic factors that induce cell fate specification and selective expansion of specified neural cell subsets. Modulation of cell migration is another possible role that IGF1R activation may play in neurogenesis. In the mature brain, IGF-I binding sites have been found in different regions of the brain, and multiple reports confirmed a strong neuroprotective action of the IGF-IR against different pro-apoptotic insults. IGF1R is an important signaling molecule in cancer cells and plays an essential role in the establishment and maintenance of the transformed phenotype. Inhibition of IGF1R signaling thus appears to be a promising strategy to interfere with the growth and survival of cancer cells. IGF1R is frequently overexpressed by tumours, and mediates proliferation and apoptosis protection. IGF signalling also influences hypoxia signalling, protease secretion, tumour cell motility and adhesion, and thus can affect the propensity for invasion and metastasis. Therefore, the IGF1R is now an attractive anti-cancer treatment target.

  • Bhr C, et al. (2004) The insulin like growth factor-1 receptor (IGF-1R) as a drug target: novel approaches to cancer therapy. Growth Horm IGF Res. 14 (4): 287-95.
  • Riedemann J, et al. (2006) IGF1R signalling and its inhibition. Endocr Relat Cancer. 13 Suppl 1: 33-43.
  • Gualco E, et al. (2009) IGF-IR in neuroprotection and brain tumors. Front Biosci. 14: 352-75.
  • Annenkov A. (2009) The insulin-like growth factor (IGF) receptor type 1 (IGF1R) as an essential component of the signalling network regulating neurogenesis. Mol Neurobiol. 40 (3): 195-215.
  • Size / Price
    Каталог: HG10164-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.