Быстрый заказ

Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human LAMP3 Информация о продукте «Клон cDNA»
Размер кДНК:1251bp
Описание кДНК:Full length Clone DNA of Homo sapiens lysosomal-associated membrane protein 3 with N terminal HA tag.
Синоним гена:LAMP, CD208, DCLAMP, TSC403, DC-LAMP, LAMP3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10527-ACGRBS15400
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10527-ACRRBS15400
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10527-CFRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10527-CHRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10527-CMRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10527-CYRBS13340
Человек CD208/DC-LAMP Джин клон кДНК в вектор клонированияHG10527-MRBS5130
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10527-M-FRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10527-NFRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10527-NHRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10527-NMRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10527-NYRBS13340
Человек CD208/DC-LAMP Джин ORF экспрессии кДНК клона плазмидыHG10527-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Dendritic cell-lysosomal associated membrane protein (DC-LAMP)/CD208, also known as LAMP3, is a member of the lysosomal associated membrane protein (LAMP) family, which is specifically expressed by human dendritic cells (DCs) upon activation and therefore serves as marker of human DC maturation. Confocal and immunoelectron microscopy showed that mouse DC-LAMP protein co-localizes with lbm180, a specific marker for the limiting membrane of lamellar bodies that contain surfactant protein B. The present study demonstrates that DC-LAMP is constitutively expressed by mouse, sheep, and human type II pneumocytes. DC-LAMP is constitutively expressed in normal type II pneumocytes. DC-LAMP is detected first in activated human DC within MHC class II molecules-containing compartments just before the translocation of MHC class II-peptide complexes to the cell surface, suggesting a possible involvement in this process. Furthermore, overexpression of LAMP3 is actively involved in tumor invasion through increased migration into lymph-vascular spaces.

  • Salaun B, et al. (2003) Cloning and characterization of the mouse homologue of the human dendritic cell maturation marker CD208/DC-LAMP. Eur J Immunol. 33(9): 2619-29.
  • Salaun B, et al. (2004) CD208/dendritic cell-lysosomal associated membrane protein is a marker of normal and transformed type II pneumocytes. Am J Pathol. 164(3): 861-71.
  • Ishigami S, et al. (2010) Prognostic value of CD208-positive cell infiltration in gastric cancer. Cancer Immunol Immunother. 59(3): 389-95.
  • Size / Price
    Каталог: HG10527-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.