CD200R cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

CD200R cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Human CD200 receptor 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD200R cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CD200R cDNA ORF Clone, Human; HCRTR2 cDNA ORF Clone, Human; MOX2R cDNA ORF Clone, Human; OX2R cDNA ORF Clone, Human

CD200R Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cell surface glycoprotein CD2 receptor 1 (CD2R1) is an isoform of CD2 receptors which is expressed on cells of the myeloid lineage. CD2R1 is a receptor for the OX-2 membrane glycoprotein. The receptor-substrate interaction may serve as a myeloid downregulatory signal.
Full Name
CD200 receptor 1
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait