After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001767.3
Размер кДНК:1056bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD2 molecule with C terminal Flag tag.
Синоним гена:T11, SRBC
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10982-ACGRBS15400
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10982-ACRRBS15400
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10982-CFRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10982-CHRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10982-CMRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10982-CYRBS13340
Человек CD2 Джин клон кДНК в вектор клонированияHG10982-MRBS5130
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10982-M-FRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10982-NFRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10982-NHRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10982-NMRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10982-NYRBS13340
Человек CD2 Джин ORF экспрессии кДНК клона плазмидыHG10982-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I membrane protein. It contains one Ig-like C2-type domain and one Ig-like V-type domain. CD2 is a cell adhesion molecule expressed on T cells and is recognized as a target for CD48 (rats) and CD58 (humans). CD2 has been shown to set quantitative thresholds in T cell activation both in vivo and in vitro. Further, intracellular CD2 signaling pathways and networks are being discovered by the identification of several cytosolic tail binding proteins. CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain of CD2 is implicated in the signaling function. The complex of CD2 and CD58 also plays an important role in enhancing the adhesion of T lymphocytes to target cells, and promoting hyperplasia and activation of T lymphocytes. As a cell surface glycoprotein, CD2 expressed on most human T cells and natural killer (NK) cells and plays an important role in mediating cell adhesion in both T-lymphocytes and in signal transduction.

Ссылки
  • Yang JJ, et al. (2001) Structural biology of the cell adhesion protein CD2: alternatively folded states and structure-function relation. Curr Protein Pept Sci. 2(1): 1-17.
  • Wilkins AL, et al. (2003) Structural biology of the cell adhesion protein CD2: from molecular recognition to protein folding and design. Curr Protein Pept Sci. 4(5): 367-73.
  • McNerney ME, et al. (2006) The CD2 family of natural killer cell receptors. Curr Top Microbiol Immunol. 298: 91-120.
  • Size / Price
    Каталог: HG10982-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».