RP105 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

RP105 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1986 bp
Description
Full length Clone DNA of Human CD180 molecule with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RP105 cDNA ORF Clone, Human, N-His tag: Alternative Names

LY64 cDNA ORF Clone, Human; Ly78 cDNA ORF Clone, Human; RP105 cDNA ORF Clone, Human

RP105 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD18, also known as RP15, is a B-cell surface molecule belonging to the family of pathogen receptors, Toll-like receptors (TLR). CD18 has an extracellular leucine-rich repeats and a short cytoplasmic tail. CD18 / RP15 interact with an extracellular molecule named MD1 and then together form the cell surface receptor complex RP15 / MD1 which induces B-cell activation in humans and mice, leading to proliferation and up-regulation of a costimulatory molecule, B7.2 / CD86. CD18 / RP15 also has a role in LPS response because B cells lacking RP15 show hyporesponsiveness to LPS.
Full Name
CD180 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Nagai Y, et al. (2002) Requirement for MD-1 in cell surface expression of RP105/CD180 and B-cell responsiveness to lipopolysaccharide. Journal of the American society of hematology. 99(5): 1699-705.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait