After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD163L1 Информация о продукте «Клон cDNA»
Размер кДНК:4362bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD163 molecule-like 1 with N terminal HA tag.
Синоним гена:M160, CD163B
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14039-ACGRBS25660
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14039-ACRRBS25660
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14039-CFRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14039-CHRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14039-CMRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14039-CYRBS23610
Человек CD163L1 Джин клон кДНК в вектор клонированияHG14039-GRBS5130
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14039-G-HRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14039-NFRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14039-NHRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14039-NMRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14039-NYRBS23610
Человек CD163L1 Джин ORF экспрессии кДНК клона плазмидыHG14039-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14039-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.