Быстрый заказ

Text Size:AAA

Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD160 Информация о продукте «Клон cDNA»
Размер кДНК:546bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD160 molecule with C terminal Myc tag.
Синоним гена:NK1, BY55, NK28, CD160
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12191-ACGRBS15400
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12191-ACRRBS15400
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12191-CFRBS13340
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12191-CHRBS13340
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12191-CMRBS13340
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12191-CYRBS13340
Человек CD160/NK1/BY55 Джин клон кДНК в вектор клонированияHG12191-GRBS5130
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12191-NFRBS13340
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12191-NHRBS13340
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12191-NMRBS13340
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12191-NYRBS13340
Человек CD160/NK1/BY55 Джин ORF экспрессии кДНК клона плазмидыHG12191-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD160 antigen, also known as Natural killer cell receptor BY55 and CD160, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD160 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is expressed in spleen, peripheral blood, and small intestine. Expression of CD160 is restricted to functional NK and T cytotoxic lymphocytes. CD160 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD160+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD160 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.

  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
  • Size / Price
    Каталог: HG12191-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.