After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PVR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001135768.1
Размер кДНК:1119bp
Описание кДНК:Full length Clone DNA of Homo sapiens poliovirus receptor (PVR),transcript variant 2 with N terminal His tag.
Синоним гена:CD155, PVS, HVED, PVR, NECL5, TAGE4, Necl-5
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10110-ACGRBS15396
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10110-ACRRBS15396
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10110-CFRBS13343
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10110-CHRBS13343
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10110-CMRBS13343
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10110-CYRBS13343
Человек CD155/PVR transcript variant 2 Джин клон кДНК в вектор клонированияHG10110-MRBS5132
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10110-NFRBS13343
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10110-NHRBS13343
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10110-NMRBS13343
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10110-NYRBS13343
Человек CD155/PVR transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10110-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.

Ссылки
  • Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.
  • Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.
  • Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.
  • Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.
  • Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.
  • Size / Price
    Каталог: HG10110-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».