After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MCAM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006500.2
Размер кДНК:1941bp
Описание кДНК:Full length Clone DNA of Homo sapiens melanoma cell adhesion molecule with N terminal His tag.
Синоним гена:MCAM, CD146, MUC18
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10115-ACGRBS16760
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10115-ACRRBS16760
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10115-CFRBS14710
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10115-CHRBS14710
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10115-CMRBS14710
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10115-CYRBS14710
Человек CD146/MCAM Джин клон кДНК в вектор клонированияHG10115-MRBS5130
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10115-NFRBS14710
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10115-NHRBS14710
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10115-NMRBS14710
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10115-NYRBS14710
Человек CD146/MCAM Джин ORF экспрессии кДНК клона плазмидыHG10115-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein belonging to the immunoglobulin superfamily. CD146 contains the characteristic immunoglobulin-like domains (V-V-C2-C2-C2), a transmembrane region and a short cytoplasmic tail. The CD146 expression is detected in endothelial cells in vascular tissue throughout the body, and plays a role in cell adhesion, as well as in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. As a Ca2+-independent cell adhesion molecule involved in heterophilic cell to cell interactions and a surface receptor, CD146 triggers tyrosine phosphorylation of FYN and PTK2 and subsequently induced signal transduction, proteolysis, or immune recognition. This protein is also expressed predominantly on metastatic lesions and advanced primary tumours, and thus has been suggested to play an important role in tumour progression and the development of metastasis in certain human carcinomas.

Ссылки
  • Mills L, et al. (2002) Fully human antibodies to MCAM/MUC18 inhibit tumor growth and metastasis of human melanoma. Cancer Res. 62(17): 5106-14.
  • Taira E, et al. (2004) Characterization of Gicerin/MUC18/CD146 in the rat nervous system. J Cell Physiol. 198(3): 377-87.
  • Fritzsche FR, et al. (2008) CD146 protein in prostate cancer: revisited with two different antibodies. Pathology. 40(5): 457-64.
  • Bidlingmaier S, et al. (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res. 69(4): 1570-7.
  • Boneberg EM, et al. (2009) Soluble CD146 is generated by ectodomain shedding of membrane CD146 in a calcium-induced, matrix metalloprotease-dependent process. Microvasc Res. 78(3): 325-31.
  • Size / Price
    Каталог: HG10115-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».