PDGFRB cDNA ORF Clone, Human, untagged

Cat: HG10514-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PDGFRB Reagents

CRO Services

Product recommended


All PDGFRB Reagents

PDGFRB cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
3321 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human platelet-derived growth factor receptor, beta polypeptide.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 3.31kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PDGFRB cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGFRB cDNA ORF Clone, Human, untagged Alternative Names

CD140B cDNA ORF Clone, Human;IBGC4 cDNA ORF Clone, Human;IMF1 cDNA ORF Clone, Human;JTK12 cDNA ORF Clone, Human;KOGS cDNA ORF Clone, Human;PDGFR cDNA ORF Clone, Human;PDGFR-1 cDNA ORF Clone, Human;PDGFR1 cDNA ORF Clone, Human;PENTT cDNA ORF Clone, Human

PDGFRB Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD140b, also known as PDGFRB, is a member of the CD system. CD140b is a cell surface tyrosine kinase receptor essencial for development interacting with the platelet-derived growth factors (PDGFs) which serves as mitogens for mesenchymal cells. CD140b can bind with platelet-derived growth factor (PDGF)-B, that are secreted by tumors and phosphorylation of PDGFR-β was correlated with depth of cancer invasion at statistically significant level.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
platelet-derived growth factor receptor, beta polypeptide
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Suzuki S, et al. (2010) Clinicopathological significance of platelet-derived growth factor (PDGF)-B and vascular endothelial growth factor-A expression, PDGF receptor- phosphorylation, and microvessel density in gastric cancer. BMC cancer. 10: 659.
  • PDGFRB cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    PDGFRB cDNA ORF Clone in Cloning Vector, Rhesus CG90215-G
    PDGFRB cDNA ORF Clone, Rhesus, untagged CG90215-UT
    PDGFRB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90215-ACGLN
    PDGFRB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90215-ACG
    PDGFRB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90215-ACR
    PDGFRB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90215-CF
    PDGFRB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90215-NF
    PDGFRB cDNA ORF Clone, Rhesus, C-His tag CG90215-CH
    PDGFRB cDNA ORF Clone, Rhesus, N-His tag CG90215-NH
    PDGFRB cDNA ORF Clone, Rhesus, C-HA tag CG90215-CY
    PDGFRB cDNA ORF Clone, Rhesus, N-HA tag CG90215-NY
    PDGFRB cDNA ORF Clone, Rhesus, C-Myc tag CG90215-CM
    PDGFRB cDNA ORF Clone, Rhesus, N-Myc tag CG90215-NM

    PDGFRB cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PDGFRB cDNA ORF Clone in Cloning Vector, Rat RG80347-G
    PDGFRB cDNA ORF Clone, Rat, untagged RG80347-UT
    PDGFRB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80347-ACGLN
    PDGFRB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80347-ACG
    PDGFRB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80347-ACR
    PDGFRB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80347-CF
    PDGFRB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80347-NF
    PDGFRB cDNA ORF Clone, Rat, C-His tag RG80347-CH
    PDGFRB cDNA ORF Clone, Rat, N-His tag RG80347-NH
    PDGFRB cDNA ORF Clone, Rat, C-HA tag RG80347-CY
    PDGFRB cDNA ORF Clone, Rat, N-HA tag RG80347-NY
    PDGFRB cDNA ORF Clone, Rat, C-Myc tag RG80347-CM
    PDGFRB cDNA ORF Clone, Rat, N-Myc tag RG80347-NM
    PDGFRB qPCR Primer Pairs, Rat RP300317

    PDGFRB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDGFRB cDNA ORF Clone in Cloning Vector, Human HG10514-G
    PDGFRB cDNA ORF Clone, Human, C-GFPSpark® tag HG10514-ACG
    PDGFRB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10514-ACGLN
    PDGFRB cDNA ORF Clone, Human, C-OFPSpark® tag HG10514-ACR
    PDGFRB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10514-CF
    PDGFRB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10514-NF
    PDGFRB cDNA ORF Clone, Human, C-His tag HG10514-CH
    PDGFRB cDNA ORF Clone, Human, N-His tag HG10514-NH
    PDGFRB cDNA ORF Clone, Human, C-HA tag HG10514-CY
    PDGFRB cDNA ORF Clone, Human, N-HA tag HG10514-NY
    PDGFRB cDNA ORF Clone, Human, C-Myc tag HG10514-CM
    PDGFRB cDNA ORF Clone, Human, N-Myc tag HG10514-NM
    PDGFRB qPCR Primer Pairs, Human HP100534
    info info
    添加购物车成功! 添加购物车失败!