Быстрый заказ

Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FLT3 Информация о продукте «Клон cDNA»
Размер кДНК:2982bp
Описание кДНК:Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 3 with C terminal His tag.
Синоним гена:FLK2, STK1, CD135, FLT3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10445-ACGRBS22238
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10445-ACRRBS22238
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10445-CFRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10445-CHRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10445-CMRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10445-CYRBS20185
Человек FLT3/CD135/FLK-2 Джин клон кДНК в вектор клонированияHG10445-MRBS5132
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10445-M-FRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10445-M-HRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмидыHG10445-M-NRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10445-NFRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10445-NHRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10445-NMRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10445-NYRBS20185
Человек FLT3/CD135/FLK-2 Джин ORF экспрессии кДНК клона плазмидыHG10445-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD135, also known as FLT-3, FLK-2, is a member of the CD system. CD135 is an important cell surface marker recognized by specific sets of antibodies to identify the types of hematopoietic (blood) progenitors in the bone marrow and it function to differentiate hematopoietic stem cells, which are CD135 negative, from multipotent progenitors, which are CD135 positive. CD135 is a receptor tyrosine kinase typeⅢ for the cytokine Flt3 ligand and activat signaling through second messengers by binding to Flt3. Signaling through CD135 is important for lymphocyte development. The encoding gene CD135 is a proto-oncogene to which mutations happened will lead to cancer such as leukemia.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Bertho, et al. (2000) CD135 (Flk2 / Flt3) Expression by Human Thymocytes Delineates a Possible Role of FLT3-Ligand in T-Cell Precursor Proliferation and Differentiation. Scandinavian Journal of Immunology. 52 (1): 53-61.
  • Size / Price
    Каталог: HG10445-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.