Быстрый заказ

Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human IFNGR1 Информация о продукте «Клон cDNA»
Размер кДНК:1470bp
Описание кДНК:Full length Clone DNA of Homo sapiens interferon gamma receptor 1 with C terminal Flag tag.
Синоним гена:CD119, IFNGR, FLJ45734
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10338-ACGRBS15400
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10338-ACRRBS15400
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10338-CFRBS13340
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10338-CHRBS13340
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10338-CMRBS13340
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10338-CYRBS13340
Человек IFNGR1/CD119 Джин клон кДНК в вектор клонированияHG10338-MRBS5130
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10338-NFRBS13340
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10338-NHRBS13340
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10338-NMRBS13340
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10338-NYRBS13340
Человек IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмидыHG10338-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD119 (cluster of differentiation 119), also known as IFNGR1 ( interferon gamma receptor 1), is part of the heterodimeric gamma interferon receptor which consists of IFNGR1 (CD119) and IFNGR2. The IFNGR1 gene encodes the ligand-binding chain (alpha) of the interteron receptor while IFNGR gene encodes the non-ligand binding partner. The ability of the interferon-γ was achieved through binding to the interferon receptor CD119. After binding, the products of activated T-lymphocytes interferon-γ exerts antiviral activity, growth inhibitory effect, and several immune- regulatory activities on a variety of cell types.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Novick D, et al. (1987) The human interferon-gamma receptor. The journal of biological chemistry. 262 (18): 8483-7
  • Size / Price
    Каталог: HG10338-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.