Быстрый заказ

Text Size:AAA

Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human VCAM1 Информация о продукте «Клон cDNA»
Размер кДНК:2220bp
Описание кДНК:Full length Clone DNA of Homo sapiens vascular cell adhesion molecule 1, transcript variant 1 with N terminal His tag.
Синоним гена:VCAM1, CD106, MGC99561, INCAM-100, DKFZp779G2333
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10113-ACGRBS16760
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10113-ACRRBS16760
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10113-CFRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10113-CHRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10113-CMRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10113-CYRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин клон кДНК в вектор клонированияHG10113-MRBS5130
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10113-M-NRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10113-NFRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10113-NHRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10113-NMRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10113-NYRBS14710
Человек VCAM1/VCAM-1/CD106 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10113-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Каталог: HG10113-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.