Быстрый заказ

Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек ENG Информация о продукте «Клон cDNA»
    Размер кДНК:1977bp
    Описание кДНК:Full length Clone DNA of Homo sapiens endoglin (ENG), transcript variant 1 with N terminal Myc tag.
    Синоним гена:Eng, END, ORW, HHT1, ORW1, CD105, FLJ41744
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with ENG qPCR primers for gene expression analysis, HP100220 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10149-ACGRBS16760
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10149-ACRRBS16760
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10149-CFRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10149-CHRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10149-CMRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10149-CYRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин клон кДНК в вектор клонированияHG10149-MRBS5130
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10149-M-NRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10149-NFRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10149-NHRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10149-NMRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10149-NYRBS14710
    Человек Endoglin/CD105 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10149-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

    Size / Price
    Каталог: HG10149-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.