Быстрый заказ

Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human MME Информация о продукте «Клон cDNA»
Размер кДНК:2253bp
Описание кДНК:Full length Clone DNA of Homo sapiens membrane metallo-endopeptidase with N terminal Myc tag.
Синоним гена:NEP, CD10, CALLA, MGC126681, MGC126707, DKFZp686O16152, MME
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10805-ACGRBS16760
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10805-ACRRBS16760
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10805-CFRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10805-CHRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10805-CMRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10805-CYRBS14710
Человек CD10/Neprilysin Джин клон кДНК в вектор клонированияHG10805-MRBS5130
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмидыHG10805-M-NRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10805-NFRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10805-NHRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10805-NMRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10805-NYRBS14710
Человек CD10/Neprilysin Джин ORF экспрессии кДНК клона плазмидыHG10805-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 10 (CD10), also known as Neprilysin and neutral endopeptidase, is a member of the CD system. CD10 is a zinc-dependent metalloprotease enzyme that had function to degrade a number of small secreted peptides such as the amyloid beta peptide. It exist as a membrane-bound protein and have high concentration in kidney and lung tissues. Mutations in the CD10 gene can induce the familial forms of Alzheimer's disease, providing strong evidence for the protein's association with the Alzheimer's disease process. CD10 is also associated with other biochemical processes.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Dogan, et al. (2000) CD10 and BCL-6 Expression in Paraffin Sections of Normal Lymphoid Tissue and B-Cell Lymphomas. American Journal of Surgical Pathology. 24(6): 846-52.
  • Size / Price
    Каталог: HG10805-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.