Быстрый заказ

Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек CCT4 Информация о продукте «Клон cDNA»
Размер кДНК:1620bp
Описание кДНК:Full length Clone DNA of Homo sapiens chaperonin containing TCP1, subunit 4 (delta) with N terminal HA tag.
Синоним гена:SRB, Cctd, CCT-DELTA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with CCT4 qPCR primers for gene expression analysis, HP104375 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15784-ACGRBS16760
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15784-ACRRBS16760
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15784-ANGRBS16760
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15784-ANRRBS16760
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15784-CFRBS14710
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15784-CHRBS14710
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15784-CMRBS14710
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15784-CYRBS14710
Человек CCT4/TCP1 delta Джин клон кДНК в вектор клонированияHG15784-GRBS5130
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15784-NFRBS14710
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15784-NHRBS14710
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15784-NMRBS14710
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15784-NYRBS14710
Человек CCT4/TCP1 delta Джин ORF экспрессии кДНК клона плазмидыHG15784-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15784-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Добавить в корзинуЗапрос по оптовому заказу
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.