Быстрый заказ

Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CCRL1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_016557.2
    Размер кДНК:1053bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) receptor-like 1 with C terminal His tag.
    Синоним гена:PPR1, CCBP2, CCR10, CCR11, VSHK1, CKR-11, CCX-CKR, CC-CKR-11, CCRL1
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCRL1 qPCR primers for gene expression analysis, HP101028 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11113-ACGRBS15400
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11113-ACRRBS15400
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11113-CFRBS13340
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11113-CHRBS13340
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11113-CMRBS13340
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11113-CYRBS13340
    Человек CX3CR1 Джин клон кДНК в вектор клонированияHG11113-MRBS5130
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11113-NFRBS13340
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11113-NHRBS13340
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11113-NMRBS13340
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11113-NYRBS13340
    Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмидыHG11113-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».