Быстрый заказ

Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CCRL1 Информация о продукте «Клон cDNA»
Размер кДНК:1053bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) receptor-like 1 with C terminal His tag.
Синоним гена:PPR1, CCBP2, CCR10, CCR11, VSHK1, CKR-11, CCX-CKR, CC-CKR-11, CCRL1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11113-ACGRBS15400
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11113-ACRRBS15400
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11113-CFRBS13340
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11113-CHRBS13340
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11113-CMRBS13340
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11113-CYRBS13340
Человек CX3CR1 Джин клон кДНК в вектор клонированияHG11113-MRBS5130
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11113-NFRBS13340
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11113-NHRBS13340
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11113-NMRBS13340
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11113-NYRBS13340
Человек CX3CR1 Джин ORF экспрессии кДНК клона плазмидыHG11113-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11113-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.