Быстрый заказ

Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек CCR6 Информация о продукте «Клон cDNA»
Размер кДНК:1125bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) receptor 6 with N terminal Myc tag.
Синоним гена:BN-1, CKR6, DCR2, CD196, CKRL3, DRY-6, GPR29, CKR-L3, CMKBR6, GPRCY4, STRL22, GPR-CY4, CCR6
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
( We provide with CCR6 qPCR primers for gene expression analysis, HP101315 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11438-ACGRBS15400
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11438-ACRRBS15400
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11438-CFRBS13340
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11438-CHRBS13340
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11438-CMRBS13340
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11438-CYRBS13340
Человек CCR6 Gene cDNA clone plasmidHG11438-MRBS5130
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11438-NFRBS13340
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11438-NHRBS13340
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11438-NMRBS13340
Человек CCR6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11438-NYRBS13340
Человек CCR6 Джин ORF экспрессии кДНК клона плазмидыHG11438-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11438-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.