CCR2 cDNA ORF Clone, Human, C-His tag

Cat: HG16084-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CCR2 Reagents

CRO Services

Product recommended


All CCR2 Reagents

CCR2 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) receptor 2 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCR2 cDNA ORF Clone, Human, C-His tag Alternative Names

CC-CKR-2 cDNA ORF Clone, Human;CCR-2 cDNA ORF Clone, Human;CCR2A cDNA ORF Clone, Human;CCR2B cDNA ORF Clone, Human;CD192 cDNA ORF Clone, Human;CKR2 cDNA ORF Clone, Human;CKR2A cDNA ORF Clone, Human;CKR2B cDNA ORF Clone, Human;CMKBR2 cDNA ORF Clone, Human;MCP-1-R cDNA ORF Clone, Human

CCR2 Background Information

Full Name
chemokine (C-C motif) receptor 2

CCR2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CCR2 cDNA ORF Clone in Cloning Vector, Rhesus CG90236-G
CCR2 cDNA ORF Clone, Rhesus, untagged CG90236-UT
CCR2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90236-ACGLN
CCR2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90236-ACG
CCR2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90236-ACR
CCR2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90236-CF
CCR2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90236-NF
CCR2 cDNA ORF Clone, Rhesus, C-His tag CG90236-CH
CCR2 cDNA ORF Clone, Rhesus, N-His tag CG90236-NH
CCR2 cDNA ORF Clone, Rhesus, C-HA tag CG90236-CY
CCR2 cDNA ORF Clone, Rhesus, N-HA tag CG90236-NY
CCR2 cDNA ORF Clone, Rhesus, C-Myc tag CG90236-CM
CCR2 cDNA ORF Clone, Rhesus, N-Myc tag CG90236-NM

CCR2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CCR2 cDNA ORF Clone in Cloning Vector, Rat RG80230-G
CCR2 cDNA ORF Clone, Rat, untagged RG80230-UT
CCR2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80230-ACG
CCR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80230-ACGLN
CCR2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80230-ACR
CCR2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80230-CF
CCR2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80230-NF
CCR2 cDNA ORF Clone, Rat, C-His tag RG80230-CH
CCR2 cDNA ORF Clone, Rat, N-His tag RG80230-NH
CCR2 cDNA ORF Clone, Rat, C-HA tag RG80230-CY
CCR2 cDNA ORF Clone, Rat, N-HA tag RG80230-NY
CCR2 cDNA ORF Clone, Rat, C-Myc tag RG80230-CM
CCR2 cDNA ORF Clone, Rat, N-Myc tag RG80230-NM
CCR2 qPCR Primer Pairs, Rat RP300124

CCR2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCR2 cDNA ORF Clone in Cloning Vector, Mouse MG50853-G
CCR2 cDNA ORF Clone, Mouse, untagged MG50853-UT
CCR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50853-ACG
CCR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50853-ACGLN
CCR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50853-ACR
CCR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50853-CF
CCR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50853-G-F
CCR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50853-NF
CCR2 cDNA ORF Clone, Mouse, C-His tag MG50853-CH
CCR2 cDNA ORF Clone, Mouse, N-His tag MG50853-NH
CCR2 cDNA ORF Clone, Mouse, C-HA tag MG50853-CY
CCR2 cDNA ORF Clone, Mouse, N-HA tag MG50853-NY
CCR2 cDNA ORF Clone, Mouse, C-Myc tag MG50853-CM
CCR2 cDNA ORF Clone, Mouse, N-Myc tag MG50853-NM
CCR2 qPCR Primer Pairs, Mouse MP200824

CCR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCR2 cDNA ORF Clone in Cloning Vector, Human HG16084-G
CCR2 cDNA ORF Clone, Human, untagged HG16084-UT
CCR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16084-ACGLN
CCR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16084-ACG
CCR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16084-ACR
CCR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16084-CF
CCR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16084-NF
CCR2 cDNA ORF Clone, Human, N-His tag HG16084-NH
CCR2 cDNA ORF Clone, Human, C-HA tag HG16084-CY
CCR2 cDNA ORF Clone, Human, N-HA tag HG16084-NY
CCR2 cDNA ORF Clone, Human, C-Myc tag HG16084-CM
CCR2 cDNA ORF Clone, Human, N-Myc tag HG16084-NM
info info
添加购物车成功! 添加购物车失败!