Быстрый заказ

Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CCL8 Информация о продукте «Клон cDNA»
    Размер кДНК:300bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 8 with C terminal Flag tag.
    Синоним гена:HC14, MCP2, MCP-2, SCYA8, SCYA10
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with CCL8 qPCR primers for gene expression analysis, HP100952 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10989-ACGRBS15400
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10989-ACRRBS15400
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10989-CFRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10989-CHRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10989-CMRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10989-CYRBS13340
    Человек CCL8/MCP-2 Джин клон кДНК в вектор клонированияHG10989-MRBS5130
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10989-M-FRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмидыHG10989-M-NRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10989-NFRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10989-NHRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10989-NMRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10989-NYRBS13340
    Человек CCL8/MCP-2 Джин ORF экспрессии кДНК клона плазмидыHG10989-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 8 (CCL8), also known as monocyte chemoattractant protein 2 (MCP-2), is a small cytokine belonging to the C-C chemokine family. CCL8 functions to activate different immune cells, including mast cells, eosinophils and basophils which are involved in allergic responses, monocytes, and T cells and NK cells which are involved in the inflammatory response. CCL8's ability achieves by binding to different cell surface receptors termed chemokine receptors including CCR1, CCR2B and CCR5. It has been reported that CCL8 is a potent inhibitor of HIV-1 by virtue of its binding to CCR5 which is one of the major co-receptors for HIV-1.

  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28 (5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811–5.
  • Hori T, et al. (2008) CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 111 (8): 4403-12.
  • Biber K, et al. (2003) Expression of L-CCR in HEK 293 cells reveals functional responses to CCL2, CCL5, CCL7, and CCL8. Journal of Leukocyte Biology. 74 (2): 243-51.

    CCL8/MCP-2 related areas, pathways, and other information

    Size / Price
    Каталог: HG10989-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.