Быстрый заказ

Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CCL28 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_148672.2
Размер кДНК:384bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 28 with C terminal Myc tag.
Синоним гена:MEC, CCK1, SCYA28, MGC71902
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10618-ACGRBS15400
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10618-ACRRBS15400
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10618-CFRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10618-CHRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10618-CMRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10618-CYRBS13340
Человек CCL28/SCYA28 Джин клон кДНК в вектор клонированияHG10618-MRBS5130
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10618-M-FRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10618-NFRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10618-NHRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10618-NMRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10618-NYRBS13340
Человек CCL28/SCYA28 Джин ORF экспрессии кДНК клона плазмидыHG10618-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».