CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
285 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 26 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL26/Eotaxin-3 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

IMAC cDNA ORF Clone, Human; MIP-4a cDNA ORF Clone, Human; MIP-4alpha cDNA ORF Clone, Human; SCYA26 cDNA ORF Clone, Human; TSC-1 cDNA ORF Clone, Human

CCL26/Eotaxin-3 Background Information

The eotaxin subfamily of CC chemokines consists of eotaxin-1/CCL11, eotaxin-2/CCL24 and eotaxin-3/CCL26. All eotaxins induce the trafficking of eosinophils to the sites of inflammation via CC chemokine receptor 3 (CCR3), which is also expressed by several different cell types, including basophils, dendritic cells, smooth muscle cells, epithelial cells and fibroblasts. The sequence similarity between the three eotaxins is limited (<4%), but their functional properties are very similar. Eotaxin-1 and -2 are expressed by both haematopoietic and non-haematopoietic cells, but eotaxin-3 expression has been reported to be limited to non-haematopoietic cells. Interleukin (IL)-4 is the main inducer for eotaxin-3 expression, whereas eotaxin-1 is up-regulated by IL-4 and the proinflammatory cytokine tumour necrosis factor (TNF)-α. Eotaxin-3 is expressed in vascular endothelial cells and human dermal fibroblasts after IL-4 and IL-13 stimulation, and this is dependent upon the IL-4-/IL-13-specific transcription factor, signal transducers and activator of transcription (STAT)-6. Eotaxin-3 is expressed on the surface of IL-4-stimulated endothelial cells and promotes eosinophil transmigration.
Full Name
chemokine (C-C motif) ligand 26
References
  • Takahashi K, Imaeda H, Fujimoto T, et al. Regulation of eotaxin-3/CC chemokine ligand 26 expression by T helper type 2 cytokines in human colonic myofibroblasts. Clinical and Experimental Immunology. 2013;173(2):323-331.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait