Быстрый заказ

Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CCL21 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_002989.2
    Размер кДНК:405bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 21 with C terminal HA tag.
    Синоним гена:ECL, SLC, CKb9, TCA4, 6Ckine, SCYA21, MGC34555, CCL21
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCL21 qPCR primers for gene expression analysis, HP100499 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10477-ACGRBS15400
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10477-ACRRBS15400
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10477-CFRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10477-CHRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10477-CMRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10477-CYRBS13340
    Человек CCL21/6Ckine Джин клон кДНК в вектор клонированияHG10477-MRBS5130
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10477-M-FRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10477-NFRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10477-NHRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10477-NMRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10477-NYRBS13340
    Человек CCL21/6Ckine Джин ORF экспрессии кДНК клона плазмидыHG10477-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 21(CCL21), also known as 6Ckine, exodus-2, and secondary lymphoid-tissue chemokine(SLC), is a small cytokine belonging to the C-C chemokine family. CCL21 takes its name 6Ckine for its consititutively six conserved cysteine residues but not four cysteines typical to chemokines. CCL21 has function in ininducing vigorous calcium migrations and chemotactic responses.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Yoshida R, et al. (1998) Secondary lymphoid-tissue chemokine is a functional ligand for the CC chemokine receptor CCR7. The journal of biological chemistry. 273: 7118-22.
  • Size / Price
    Каталог: HG10477-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».