Быстрый заказ

Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CCL20 Информация о продукте «Клон cDNA»
    Размер кДНК:288bp
    Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 20, transcript variant 2 with C terminal HA tag.
    Синоним гена:CKb4, LARC, ST38, MIP3A, MIP-3a, SCYA20, CCL20
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with CCL20 qPCR primers for gene expression analysis, HP100507 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10485-ACGRBS15400
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10485-ACRRBS15400
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10485-CFRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10485-CHRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10485-CMRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10485-CYRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин клон кДНК в вектор клонированияHG10485-MRBS5130
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10485-NFRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10485-NHRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10485-NMRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10485-NYRBS13340
    Человек CCL20/MIP-3 alpha/MIP3A transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10485-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Chemokine (C-C motif) ligand 20 (CCL20) or liver activation regulated chemokine (LARC) or Macrophage Inflammatory Protein-3 (MIP3A) is a small cytokine belonging to the CC chemokine family that attracts immature dendritic cells and memory T lymphocytes, both expressing CCR6. Depending on the cell type, this chemokine was found to be inducible by cytokines (IL-1beta) and by bacterial, viral, or plant products (including LPS, dsRNA, and PMA). MIP3A / CCL20 is Expressed predominantly in the liver, lymph nodes, appendix, peripheral blood lymphocytes, and fetal lung. Low levels of MIP3A / CCL20 has been seen in thymus, prostate, testis, small intestine and colon. As a chemotactic factor, MIP3A / CCL20 attracts lymphocytes and, slightly, neutrophils, but not monocytes. This chemokine may Inhibit proliferation of myeloid progenitors in colony formation assays and it may be involved in formation and function of the mucosal lymphoid tissues by attracting lymphocytes and dendritic cells towards epithelial cells. Its C-terminal processed forms have been shown to be equally chemotactically active for leukocytes. Chemokine CCL20 was shown to play a role in colorectal cancer (CRC) pathogenesis.

  • Vicinus B, et al. (2012) miR-21 functionally interacts with the 3'UTR of chemokine CCL20 and down-regulates CCL20 expression in miR-21 transfected colorectal cancer cells. Cancer Lett. 316(1): 105-12.
  • Ding X, et al. (2012) High Expression of CCL20 Is Associated with Poor Prognosis in Patients with Hepatocellular Carcinoma after Curative Resection. J Gastrointest Surg. 16(4): 828-36.
  • Ivison SM, et al. (2010) Oxidative stress enhances IL-8 and inhibits CCL20 production from intestinal epithelial cells in response to bacterial flagellin. Am J Physiol Gastrointest Liver Physiol. 299(3): 733-41.
  • Size / Price
    Каталог: HG10485-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.