CCL18 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

CCL18 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
270 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL18 cDNA ORF Clone, Human, N-HA tag: Alternative Names

AMAC-1 cDNA ORF Clone, Human; AMAC1 cDNA ORF Clone, Human; CCL18 cDNA ORF Clone, Human; CKb7 cDNA ORF Clone, Human; DC-CK1 cDNA ORF Clone, Human; DCCK1 cDNA ORF Clone, Human; MIP-4 cDNA ORF Clone, Human; MIP4 cDNA ORF Clone, Human; PARC cDNA ORF Clone, Human; SCYA18 cDNA ORF Clone, Human

CCL18 Background Information

CCL18 is a chemotactic cytokine involved in the pathogenesis and progression of various disorders, including cancer. Proof showed high levels of CCL18 in the serum of epithelial ovarian carcinoma patients suggesting its potential as a circulating biomarker. CCL18 chemokine has an important role in chemokine-mediated tumor metastasis, and may serve as a potential predictor for poor survival outcomes for ovarian cancer. (CCL18) is predominantly secreted by M2-tumor associated macrophages (TAMs) and promotes malignant behaviors of various human cancer types. CCL18 has a correlation with cardiac function in patients with AAMI and it might be considered as an indicator of poor LVEF in patients with AAMI. Circulating and WAT-secreted CCL18 correlates with insulin resistance and metabolic risk score. Because CCL18 is macrophage-specific and associates with adipose immune gene expression, it may constitute a marker of WAT inflammation. Macrophages are thought to be the main source of CCL18, and the effect of pirfenidone, an anti-fibrotic agent for idiopathic pulmonary fibrosis, on the expression of CCL18 in macrophages warrants investigation.
Full Name
chemokine (C-C motif) ligand 18
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait