Быстрый заказ

Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CCL14 Информация о продукте «Клон cDNA»
Размер кДНК:282bp
Описание кДНК:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 14 with C terminal HA tag.
Синоним гена:CC-1, CC-3, CKb1, MCIF, NCC2, SY14, HCC-1, HCC-3, NCC-2, SCYL2, SCYA14, CCL14
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10476-ACGRBS15400
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10476-ACRRBS15400
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10476-CFRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10476-CHRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10476-CMRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10476-CYRBS13340
Человек CCL14 Джин клон кДНК в вектор клонированияHG10476-MRBS5130
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10476-M-FRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10476-NFRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10476-NHRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10476-NMRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10476-NYRBS13340
Человек CCL14 Джин ORF экспрессии кДНК клона плазмидыHG10476-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Knappe S, et al. (1996) HCC-1, a novel chemokine from human plasma. J Exp Med. 183: 295-9.
  • Naruse, et al. (1996) A YAC contig of the human CC chemokine genes clustered on chromosome 17q11.2. Genomics. 34: 236-40.

    CCL14/HCC-1/HCC-3 related areas, pathways, and other information

    Size / Price
    Каталог: HG10476-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.