After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CCDC9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC002787
Размер кДНК:1596bp
Описание кДНК:Full length Clone DNA of Homo sapiens coiled-coil domain containing 9 with N terminal His tag.
Синоним гена:CCDC9
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14845-ACGRBS16760
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14845-ACRRBS16760
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14845-ANGRBS16760
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14845-ANRRBS16760
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14845-CFRBS14710
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14845-CHRBS14710
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14845-CMRBS14710
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14845-CYRBS14710
Человек CCDC9 Джин клон кДНК в вектор клонированияHG14845-GRBS5130
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14845-NFRBS14710
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14845-NHRBS14710
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14845-NMRBS14710
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14845-NYRBS14710
Человек CCDC9 Джин ORF экспрессии кДНК клона плазмидыHG14845-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14845-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».