Быстрый заказ

Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CCDC50 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC065004
    Размер кДНК:921bp
    Описание кДНК:Full length Clone DNA of Homo sapiens coiled-coil domain containing 50 DNA.
    Синоним гена:YMER, C3orf6, DFNA44
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCDC50 qPCR primers for gene expression analysis, HP103877 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15251-ACGRBS15400
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15251-ACRRBS15400
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15251-ANGRBS15400
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15251-ANRRBS15400
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15251-CFRBS13340
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15251-CHRBS13340
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15251-CMRBS13340
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15251-CYRBS13340
    Человек CCDC50 Джин клон кДНК в вектор клонированияHG15251-GRBS5130
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15251-NFRBS13340
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15251-NHRBS13340
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15251-NMRBS13340
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15251-NYRBS13340
    Человек CCDC50 Джин ORF экспрессии кДНК клона плазмидыHG15251-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15251-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».