After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CCDC50 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC065004
Размер кДНК:921bp
Описание кДНК:Full length Clone DNA of Homo sapiens coiled-coil domain containing 50 DNA.
Синоним гена:YMER, C3orf6, DFNA44
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15251-ACGRBS15400
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15251-ACRRBS15400
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15251-ANGRBS15400
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15251-ANRRBS15400
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15251-CFRBS13340
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15251-CHRBS13340
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15251-CMRBS13340
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15251-CYRBS13340
Человек CCDC50 Джин клон кДНК в вектор клонированияHG15251-GRBS5130
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15251-NFRBS13340
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15251-NHRBS13340
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15251-NMRBS13340
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15251-NYRBS13340
Человек CCDC50 Джин ORF экспрессии кДНК клона плазмидыHG15251-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15251-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».