Быстрый заказ

Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CAT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001752.3
Размер кДНК:1584bp
Описание кДНК:Full length Clone DNA of Homo sapiens catalase with N terminal HA tag.
Синоним гена:MGC138422, MGC138424, CAT
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12084-ACGRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12084-ACRRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12084-ANGRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12084-ANRRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12084-CFRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12084-CHRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12084-CMRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12084-CYRBS14710
Человек CAT/Catalase Джин клон кДНК в вектор клонированияHG12084-GRBS5130
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмидыHG12084-G-NRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12084-NFRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12084-NHRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12084-NMRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12084-NYRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмидыHG12084-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

Ссылки
  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Size / Price
    Каталог: HG12084-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».