After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CAT Информация о продукте «Клон cDNA»
Размер кДНК:1584bp
Описание кДНК:Full length Clone DNA of Homo sapiens catalase with N terminal Flag tag.
Синоним гена:MGC138422, MGC138424, CAT
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1206C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12084-ACGRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12084-ACRRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12084-ANGRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12084-ANRRBS16760
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12084-CFRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12084-CHRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12084-CMRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12084-CYRBS14710
Человек CAT/Catalase Джин клон кДНК в вектор клонированияHG12084-GRBS5130
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмидыHG12084-G-NRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12084-NFRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12084-NHRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12084-NMRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12084-NYRBS14710
Человек CAT/Catalase Джин ORF экспрессии кДНК клона плазмидыHG12084-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Size / Price
    Каталог: HG12084-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.