Быстрый заказ

Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CASP9 Информация о продукте «Клон cDNA»
Размер кДНК:1251bp
Описание кДНК:Full length Clone DNA of Homo sapiens caspase 9, apoptosis-related cysteine peptidase with C terminal HA tag.
Синоним гена:MCH6, APAF3, APAF-3, ICE-LAP6, CASPASE-9c, CASP9
Участок рестрикции:KpnI + XbaI (6kb + 1.29kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CASP9 Gene Plasmid Map
Human CASP9 natural ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11151-ACGRBS15400
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11151-ACRRBS15400
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11151-ANGRBS15400
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11151-ANRRBS15400
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11151-CFRBS13340
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11151-CHRBS13340
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11151-CMRBS13340
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11151-CYRBS13340
Человек Caspase-9 Джин клон кДНК в вектор клонированияHG11151-MRBS5130
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11151-NFRBS13340
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11151-NHRBS13340
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11151-NMRBS13340
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11151-NYRBS13340
Человек Caspase-9 Джин ORF экспрессии кДНК клона плазмидыHG11151-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11151-CY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human CASP9 natural ORF mammalian expression plasmid, C-HA tag
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.