Быстрый заказ

Text Size:AAA

Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CASP4 Информация о продукте «Клон cDNA»
Размер кДНК:1134bp
Описание кДНК:Full length Clone DNA of Homo sapiens caspase 4, apoptosis-related cysteine peptidase, transcript variant alpha with C terminal HA tag.
Синоним гена:TX, ICH-2, Mih1/TX, ICEREL-II, ICE(rel)II, CASP4
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11158-ACGRBS15400
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11158-ACRRBS15400
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11158-ANGRBS15400
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11158-ANRRBS15400
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11158-CFRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11158-CHRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11158-CMRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11158-CYRBS13340
Человек Caspase 4 transcript variant alpha Джин клон кДНК в вектор клонированияHG11158-MRBS5130
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11158-M-FRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11158-NFRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11158-NHRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11158-NMRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11158-NYRBS13340
Человек Caspase 4 transcript variant alpha Джин ORF экспрессии кДНК клона плазмидыHG11158-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11158-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.