After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CARF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC033777
Размер кДНК:2178bp
Описание кДНК:Full length Clone DNA of Homo sapiens amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 with N terminal Myc tag.
Синоним гена:CARF, DKFZp667N246, FLJ12675, FLJ21579, NYD-SP24, ALS2CR8
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14303-ACGRBS16760
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14303-ACRRBS16760
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14303-ANGRBS16760
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14303-ANRRBS16760
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14303-CFRBS14710
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14303-CHRBS14710
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14303-CMRBS14710
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14303-CYRBS14710
Человек ALS2CR8 Джин клон кДНК в вектор клонированияHG14303-GRBS5130
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14303-NFRBS14710
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14303-NHRBS14710
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14303-NMRBS14710
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14303-NYRBS14710
Человек ALS2CR8 Джин ORF экспрессии кДНК клона плазмидыHG14303-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14303-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».