After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CAPZA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006135.2
Размер кДНК:861bp
Описание кДНК:Full length Clone DNA of Homo sapiens capping protein (actin filament) muscle Z-line, alpha 1 with C terminal Flag tag.
Синоним гена:CAPZ, CAZ1, CAPPA1, CAPZA1
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11631-ACGRBS15400
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11631-ACRRBS15400
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11631-ANGRBS15400
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11631-ANRRBS15400
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11631-CFRBS13340
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11631-CHRBS13340
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11631-CMRBS13340
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11631-CYRBS13340
Человек CAPZA1 Джин клон кДНК в вектор клонированияHG11631-MRBS5130
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11631-NFRBS13340
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11631-NHRBS13340
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11631-NMRBS13340
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11631-NYRBS13340
Человек CAPZA1 Джин ORF экспрессии кДНК клона плазмидыHG11631-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».