After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CAPG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC014549
Размер кДНК:1047bp
Описание кДНК:Full length Clone DNA of Homo sapiens capping protein (actin filament), gelsolin-like.
Синоним гена:AFCP, MCP, CAPG
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14213-ACGRBS15400
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14213-ACRRBS15400
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14213-ANGRBS15400
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14213-ANRRBS15400
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14213-CFRBS13340
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14213-CHRBS13340
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14213-CMRBS13340
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14213-CYRBS13340
Человек CAPG / AFCP Джин клон кДНК в вектор клонированияHG14213-GRBS5130
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14213-NFRBS13340
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14213-NHRBS13340
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14213-NMRBS13340
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14213-NYRBS13340
Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмидыHG14213-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

Ссылки
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • Size / Price
    Каталог: HG14213-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».