Быстрый заказ

Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CAPG Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC014549
    Размер кДНК:1047bp
    Описание кДНК:Full length Clone DNA of Homo sapiens capping protein (actin filament), gelsolin-like.
    Синоним гена:AFCP, MCP, CAPG
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CAPG qPCR primers for gene expression analysis, HP102863 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14213-ACGRBS15400
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14213-ACRRBS15400
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14213-ANGRBS15400
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14213-ANRRBS15400
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14213-CFRBS13340
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14213-CHRBS13340
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14213-CMRBS13340
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14213-CYRBS13340
    Человек CAPG / AFCP Джин клон кДНК в вектор клонированияHG14213-GRBS5130
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14213-NFRBS13340
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14213-NHRBS13340
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14213-NMRBS13340
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14213-NYRBS13340
    Человек CAPG / AFCP Джин ORF экспрессии кДНК клона плазмидыHG14213-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

    Ссылки
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • Size / Price
    Каталог: HG14213-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».