Быстрый заказ

Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CAMK2G Информация о продукте «Клон cDNA»
    Размер кДНК:1557bp
    Описание кДНК:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase II gamma, transcript variant 3 with C terminal His tag.
    Синоним гена:CAMK, CAMKG, CAMK-II, FLJ16043, MGC26678, CAMK2G
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with CAMK2G qPCR primers for gene expression analysis, HP101037 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11125-ACGRBS16760
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11125-ACRRBS16760
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11125-ANGRBS16760
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11125-ANRRBS16760
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11125-CFRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11125-CHRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11125-CMRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11125-CYRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин клон кДНК в вектор клонированияHG11125-MRBS5130
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11125-M-FRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11125-NFRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11125-NHRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11125-NMRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11125-NYRBS14710
    Человек CaMKII/CAMK2G transcript variant 3 Джин ORF экспрессии кДНК клона плазмидыHG11125-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG11125-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.