After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CALHM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000039
Размер кДНК:972bp
Описание кДНК:Full length Clone DNA of Homo sapiens calcium homeostasis modulator 2.
Синоним гена:FAM26B, CALHM2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14256-ACGRBS15400
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14256-ACRRBS15400
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14256-CFRBS13340
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14256-CHRBS13340
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14256-CMRBS13340
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14256-CYRBS13340
Человек CALHM2 Джин клон кДНК в вектор клонированияHG14256-GRBS5130
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14256-NFRBS13340
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14256-NHRBS13340
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14256-NMRBS13340
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14256-NYRBS13340
Человек CALHM2 Джин ORF экспрессии кДНК клона плазмидыHG14256-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14256-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».