After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CALCB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000728.3
Размер кДНК:384bp
Описание кДНК:Full length Clone DNA of Homo sapiens calcitonin-related polypeptide beta.
Синоним гена:CALC2, CGRP2, CGRP-II, CALCB
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13283-ACGRBS15400
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13283-ACRRBS15400
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13283-CFRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13283-CHRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13283-CMRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13283-CYRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин клон кДНК в вектор клонированияHG13283-GRBS5130
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13283-NFRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13283-NHRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13283-NMRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13283-NYRBS13340
Человек CALCB / CGPR / Calcitonin 2 Джин ORF экспрессии кДНК клона плазмидыHG13283-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CALCB, also known as CGPR and calcitonin 2, belongs to the calcitonin family. CALCB is a calcitonin (CT) peptide which may play a role in the mediation of human inflammatory diseases. It is highly expressed in the skin, blood, and cerebrospinal fluid. CGRP immunolabeling (IL) was detected in epidermal keratinocytes at levels that were especially high and widespread in the skin of humans from locations afflicted with postherpetic neuralgia (PHN) and complex region pain syndrome type 1 (CRPS), of monkeys infected with simian immunodeficiency virus, and of rats subjected to L5/L6 spinal nerve ligation, sciatic nerve chronic constriction, and subcutaneous injection of complete Freund's adjuvant. Increased CGRP-IL was also detected in epidermal keratinocytes of transgenic mice with keratin-14 promoter driven overexpression of noggin, an antagonist to BMP-4 signaling. CGPR dilates a variety of vessels including the coronary, cerebral and systemic vasculature.

Ссылки
  • Lambert NA. 2008, Sci Signal. 1 (25): re5.
  • Linscheid P. et al., 2005, Endocrinology. 146 (6): 2699-708.
  • Hou Q. et al., 2011, Pain. 152 (9): 2036-51.
  • Size / Price
    Каталог: HG13283-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие4-5 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».