After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CADM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014333.3
Размер кДНК:1329bp
Описание кДНК:Full length Clone DNA of Homo sapiens cell adhesion molecule 1 with N terminal HA tag.
Синоним гена:BL2, ST17, IGSF4, NECL2, RA175, TSLC1, IGSF4A, Necl-2, SYNCAM, sgIGSF, sTSLC-1, synCAM1, MGC51880, MGC149785, DKFZp686F1789, CADM1
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11168-ACGRBS15400
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11168-ACRRBS15400
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11168-CFRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11168-CHRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11168-CMRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11168-CYRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин клон кДНК в вектор клонированияHG11168-MRBS5130
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11168-NFRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11168-NHRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11168-NMRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11168-NYRBS13340
Человек SynCam/CADM1/TSLC1/IGSF4 Джин ORF экспрессии кДНК клона плазмидыHG11168-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like intercellular adhesion molecule. Three Ig-like domains are included in the extracellular domain of IGSF4 and mediate homophilic or heterophilic interactions independently of Ca2+. The cytoplasmic domain of IGSF4 contains the binding motifs that connect to actin fibers. Since IGSF4 has been characterized by several independent research groups, this molecule is called by three names, TSLC1, SgIGSF and SynCAM. IGSF4 was first characterized as a tumor suppressor of non-small cell lung cancer and termed TSLC1. It is a single-pass type I membrane protein which belongs to the nectin family, which may be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. In addition, CADM1 may play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa. In neuroblastoma, loss of CADM1 expression has recently been found in disseminated tumours with adverse outcome, prompting us to investigate its role in neuroblastoma tumour progression. The downregulation of CADM1 tumour suppressor gene expression is a critical event in neuroblastoma pathogenesis resulting in tumour progression.

Ссылки
  • Watabe K, et al. (2003) IGSF4: a new intercellular adhesion molecule that is called by three names, TSLC1, SgIGSF and SynCAM, by virtue of its diverse function. Histol Histopathol. 18(4): 1321-9.
  • Fujita E, et al. (2005) Distribution of RA175/TSLC1/SynCAM, a member of the immunoglobulin superfamily, in the developing nervous system. Brain Res Dev Brain Res. 154(2): 199-209.
  • Fujita E, et al. (2006) Oligo-astheno-teratozoospermia in mice lacking RA175/TSLC1/SynCAM/IGSF4A, a cell adhesion molecule in the immunoglobulin superfamily. Mol Cell Biol. 26(2): 718-26.
  • Nowacki S, et al. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene. 27(23): 3329-38.
  • Size / Price
    Каталог: HG11168-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».