CA5A cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

CA5A cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Human carbonic anhydrase VA, mitochondrial with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CA5A cDNA ORF Clone, Human, N-HA tag: Alternative Names

CA5 cDNA ORF Clone, Human; CA5AD cDNA ORF Clone, Human; CA5D cDNA ORF Clone, Human; Carbonic Anhydrase VA cDNA ORF Clone, Human; CAV cDNA ORF Clone, Human; CAVA cDNA ORF Clone, Human; GS1-21A4.1 cDNA ORF Clone, Human

CA5A Background Information

Carbonic anhydrase 5A, mitochondrial, also known as Carbonate dehydratase VA, Carbonic anhydrase VA, CA-VA and CA5A, is a member of thealpha-carbonic anhydrase family. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt).
Full Name
carbonic anhydrase VA, mitochondrial
References
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
Add to Cart Successfully Add to Cart Failed