Быстрый заказ

Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CA5A Информация о продукте «Клон cDNA»
Размер кДНК:918bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbonic anhydrase VA, mitochondrial with N terminal HA tag.
Синоним гена:CA5, CAV, CAVA
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10500-ACGRBS15400
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10500-ACRRBS15400
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10500-ANGRBS15400
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10500-ANRRBS15400
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10500-CFRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10500-CHRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10500-CMRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10500-CYRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин клон кДНК в вектор клонированияHG10500-MRBS5130
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10500-NFRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10500-NHRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10500-NMRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10500-NYRBS13340
Человек Carbonic Anhydrase VA/CA5A Джин ORF экспрессии кДНК клона плазмидыHG10500-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Carbonic anhydrase 5A, mitochondrial, also known as Carbonate dehydratase VA, Carbonic anhydrase VA, CA-VA and CA5A, is a member of the alpha-carbonic anhydrase family. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt).

  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.