Быстрый заказ

Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CA14 Информация о продукте «Клон cDNA»
Размер кДНК:960bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbonic anhydrase XIV with C terminal His tag.
Синоним гена:CAXiV
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10458-ACGRBS15400
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10458-ACRRBS15400
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10458-CFRBS13340
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10458-CHRBS13340
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10458-CMRBS13340
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10458-CYRBS13340
Human CA XIV Gene cDNA clone plasmidHG10458-MRBS3620
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10458-NFRBS13340
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10458-NHRBS13340
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10458-NMRBS13340
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10458-NYRBS13340
Человек Carbonic Anhydrase XIV Джин клон кДНК в вектор клонированияHG10458-URBS5130
Человек Carbonic Anhydrase XIV Джин ORF экспрессии кДНК клона плазмидыHG10458-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. CAXIV is a member of CA family that showed an overall similarity of 29–46% to other active CA isozymes. The highest percentage similarity was with a transmembrane CA isoform, CAXII. The CAXIV was found high concentrations in human heart, brain, liver, and skeletal muscle but lower in the colon, small intestine, urinary bladder, and kidney. No CAXIV mRNA was seen in the salivary gland and pancreas. CAXIV is a likely candidate for the extracellular CA postulated to have an important role in modulating excitatory synaptic transmission in brain.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Parkkila S, et al. (2001) Expression of membrane-associated carbonic anhydrase XIV on neurons and axons in mouse and human brain. PNAS. 98(4): 1918-23.
  • Size / Price
    Каталог: HG10458-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.