Быстрый заказ

Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CA13 Информация о продукте «Клон cDNA»
Размер кДНК:789bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbonic anhydrase XIII with C terminal His tag.
Синоним гена:CAXIII, FLJ37995, MGC59868, CA13
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10461-ACGRBS15400
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10461-ACRRBS15400
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10461-ANGRBS15400
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10461-ANRRBS15400
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10461-CFRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10461-CHRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10461-CMRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10461-CYRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин клон кДНК в вектор клонированияHG10461-MRBS5130
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10461-M-FRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10461-NFRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10461-NHRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10461-NMRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10461-NYRBS13340
Человек Carbonic Anhydrase XIII/CA13 Джин ORF экспрессии кДНК клона плазмидыHG10461-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Size / Price
    Каталог: HG10461-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.