After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CA12 Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbonic anhydrase XII with C terminal Myc tag.
Синоним гена:CAXII, FLJ20151, HsT18816
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10617-ACGRBS15400
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10617-ACRRBS15400
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10617-CFRBS13340
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10617-CHRBS13340
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10617-CMRBS13340
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10617-CYRBS13340
Человек Carbonic Anhydrase XII Джин клон кДНК в вектор клонированияHG10617-MRBS5130
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10617-NFRBS13340
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10617-NHRBS13340
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10617-NMRBS13340
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10617-NYRBS13340
Человек Carbonic Anhydrase XII Джин ORF экспрессии кДНК клона плазмидыHG10617-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA12, also known as Car12 and carbonic anhydrase XII, is a type I  membrane enzyme of an N-terminal extracellular catalytic domain, a membrane-spanning α-helix, and a small intracellular C-terminal domain. It is highly expressed in colon, kidney, prostate, intestine and activated lymphocytes and moderately expressed in pancreas, ovary, and testis. Overexpression of the CA12 is observed in certain human cancers and is used as a tumor marker. rmCA12 corresponds to the extracellular domain and has both carbonic anhydrase activity and esterase activity.

  • Sahin, U. et al., 1996, Proc. Natl. Acad. Sci. U.S.A. 92 (25): 11810–11813.
  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596 - 12601.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 16903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Size / Price
    Каталог: HG10617-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.