After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CA9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001216.2
Размер кДНК:1380bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbonic anhydrase IX with N terminal His tag.
Синоним гена:CA9, MN, CAIX
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10107-ACGRBS15400
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10107-ACRRBS15400
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10107-ANGRBS15400
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10107-ANRRBS15400
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10107-CFRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10107-CHRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10107-CMRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10107-CYRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин клон кДНК в вектор клонированияHG10107-MRBS5130
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10107-NFRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10107-NHRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10107-NMRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10107-NYRBS13340
Человек Carbonic Anhydrase IX/CA9 Джин ORF экспрессии кДНК клона плазмидыHG10107-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

Ссылки
  • Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.
  • Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.
  • Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.
  • Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.
  • Size / Price
    Каталог: HG10107-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».