Быстрый заказ

Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CA3 Информация о продукте «Клон cDNA»
    Размер кДНК:783bp
    Описание кДНК:Full length Clone DNA of Homo sapiens carbonic anhydrase III, muscle specific with N terminal HA tag.
    Синоним гена:Car3, CAIII
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with CA3 qPCR primers for gene expression analysis, HP100524 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10503-ACGRBS15400
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10503-ACRRBS15400
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10503-ANGRBS15400
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10503-ANRRBS15400
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10503-CFRBS13340
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10503-CHRBS13340
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10503-CMRBS13340
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10503-CYRBS13340
    Человек Carbonic Anhydrase III Джин клон кДНК в вектор клонированияHG10503-MRBS5130
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10503-NFRBS13340
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10503-NHRBS13340
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10503-NMRBS13340
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10503-NYRBS13340
    Человек Carbonic Anhydrase III Джин ORF экспрессии кДНК клона плазмидыHG10503-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. Carbonic anhydrases (CAs) form a family of enzymes that catalyze the rapid conversion of carbon dioxide and water to bicarbonate and protons, a reaction that occurs rather slowly in the absence of a catalyst. The active site of most carbonic anhydrases contains a zinc ion, they are therefore classified as metalloenzymes. Several forms of carbonic anhydrase occur in nature. The primary function of the enzyme in animals is to interconvert carbon dioxide and bicarbonate to maintain acid-base balance in blood and other tissues, and to help transport carbon dioxide out of tissues. Plants contain a different form called β-carbonic anhydrase, which, from an evolutionary standpoint, is a distinct enzyme, but participates in the same reaction and also uses a zinc ion in its active site.

    Carbonic anhydrase 3, also known as Carbonate dehydratase III, CA-III and CA3, is a cytoplasm protein which belongs to the alpha-carbonic anhydrase family. CA3 is activated by proton donors such as imidazole and the dipeptide histidylhistidine. It is inhibited by coumarins and sulfonamide derivatives such as acetazolamide. At 6 weeks gestation, transcripts accumulate at low levels in the somites and at high levels throughout the notochord. As gestation continues, CA3 becomes abundant in all developing muscle masses and continues at high to moderate levels in the notochord.

  • Ivanov, S.V. et al., 1998, Proc. Natl. Acad. Sci. USA 95:12596-601.
  • Sowden J. et al., 1998, Gene 214:157- 65.
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899-903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40: 257-62.
  • Bataller,L. et al., 2004, Ann Neurol  56 (4): 575-9.
  • Size / Price
    Каталог: HG10503-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.