Carbonic anhydrase II cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

Carbonic anhydrase II cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
783 bp
Description
Full length Clone DNA of Human carbonic anhydrase II with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Carbonic anhydrase II cDNA ORF Clone, Human, C-HA tag: Alternative Names

CA-II cDNA ORF Clone, Human; CAC cDNA ORF Clone, Human; CAII cDNA ORF Clone, Human; Car2 cDNA ORF Clone, Human; HEL-76 cDNA ORF Clone, Human; HEL-S-282 cDNA ORF Clone, Human

Carbonic anhydrase II Background Information

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.
Full Name
carbonic anhydrase II
References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait