Быстрый заказ

Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CA2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000067.2
Размер кДНК:783bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbonic anhydrase II with C terminal HA tag.
Синоним гена:CAII, Car2, CA-II, CA2
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10478-ACGRBS15396
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10478-ACRRBS15396
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10478-ANGRBS15396
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10478-ANRRBS15396
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10478-CFRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10478-CHRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10478-CMRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10478-CMRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10478-CYRBS13343
Человек Carbonic Anhydrase II Джин клон кДНК в вектор клонированияHG10478-MRBS5132
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10478-NFRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10478-NHRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10478-NMRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10478-NYRBS13343
Человек Carbonic Anhydrase II Джин ORF экспрессии кДНК клона плазмидыHG10478-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

Ссылки
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Каталог: HG10478-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».