After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек C8G Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human C8G Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000606.2.
Размер кДНК:609bp
Описание кДНК:Full length Clone DNA of Homo sapiens complement component 8, gamma polypeptide.
Синоним гена:C8C, MGC142186, C8G
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек C8G Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13304-ACGRBS15400
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13304-ACRRBS15400
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13304-CFRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13304-CHRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13304-CMRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13304-CYRBS13340
Человек C8G Джин клон кДНК в вектор клонированияHG13304-GRBS5130
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13304-NFRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13304-NHRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13304-NMRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13304-NYRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмидыHG13304-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13304-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».