Быстрый заказ

Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human C8G Информация о продукте «Клон cDNA»
Размер кДНК:609bp
Описание кДНК:Full length Clone DNA of Homo sapiens complement component 8, gamma polypeptide with C terminal Flag tag.
Синоним гена:C8C, MGC142186, C8G
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13304-ACGRBS15400
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13304-ACRRBS15400
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13304-CFRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13304-CHRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13304-CMRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13304-CYRBS13340
Человек C8G Джин клон кДНК в вектор клонированияHG13304-GRBS5130
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13304-NFRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13304-NHRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13304-NMRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13304-NYRBS13340
Человек C8G Джин ORF экспрессии кДНК клона плазмидыHG13304-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13304-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.